-
Add to Cart The item has been addedB648929-50mgBocidelpar
Price: $1,216.09List Price: $1,351.22Bocidelpar is a selective PPARδ modulator. Bocidelpar activates the PPARδ downstream signaling pathway, upregulates the expression of target genes such as ABCA1 and ACAA2. -
Add to Cart The item has been addedM659388-5nmolMicroRNA Mimic Negative Control (C008B-270540)
Price: $103.67List Price: $115.19MicroRNA Mimic Negative Control is a 22-nucleotide miRNA mimic and serves as a negative control.Purification: HPLCSense sequence (5'→3'): UUUGUACUACACAAAAGUACUGAntisense sequence (5'→3'): GUACUUUUGUGUAGUACAAAUU -
Add to Cart The item has been addedM659388-20nmolMicroRNA Mimic Negative Control (C008B-270539)
Price: $213.41List Price: $237.12MicroRNA Mimic Negative Control is a 22-nucleotide miRNA mimic and serves as a negative control.Purification: HPLCSense sequence (5'→3'): UUUGUACUACACAAAAGUACUGAntisense sequence (5'→3'): GUACUUUUGUGUAGUACAAAUU -
Add to Cart The item has been addedS1508402-500TSuperoxide Anion Reactive Oxygen Species (ROS) Detection Kit (DHE) (C008B-270538)
Price: $516.88List Price: $574.32Superoxide Anion Reactive Oxygen Species (ROS) Detection Kit (DHE) (C008B-270538) -
Add to Cart The item has been addedS1508402-100TSuperoxide Anion Reactive Oxygen Species (ROS) Detection Kit (DHE) (C008B-270537)
Price: $182.90List Price: $203.22Superoxide Anion Reactive Oxygen Species (ROS) Detection Kit (DHE) (C008B-270537) -
Add to Cart The item has been addedH769977-1g3-Hydroxypropionic Acid Sodium Salt
Price: $560.83List Price: $623.143-Hydroxypropionic acid is a building block in the synthesis of a variety of compounds with industrial applications, including acrylic acid, acrylamide, and 1,3-propanediol. Accumulation of 3-hydroxypropionic acid is also used as a biomarker of... -
Add to Cart The item has been addedM1508403-500TMitochondrial Superoxide Assay Kit (MitoSOX Red) (C008B-270535)
Price: $335.93List Price: $373.25Mitochondrial Superoxide Assay Kit (MitoSOX Red) (C008B-270535) -
Add to Cart The item has been addedM1508403-100TMitochondrial Superoxide Assay Kit (MitoSOX Red) (C008B-270534)
Price: $120.98List Price: $134.42Mitochondrial Superoxide Assay Kit (MitoSOX Red) (C008B-270534) -
Add to Cart The item has been addedE770829-5g1-(3-Bromo-2-chlorophenyl)ethanone
Price: $198.15List Price: $220.171-(3-Bromo-2-chlorophenyl)ethanone -
Add to Cart The item has been addedT1511146-500TTrypan Blue Staining Cell Viability Assay Kit (C008B-270532)
Price: $103.67List Price: $115.19Trypan Blue Staining Cell Viability Assay Kit (C008B-270532) -
Add to Cart The item has been addedT1511146-100TTrypan Blue Staining Cell Viability Assay Kit (C008B-270531)
Price: $39.80List Price: $44.22Trypan Blue Staining Cell Viability Assay Kit (C008B-270531) -
Add to Cart The item has been addedN477269-100gNanoclay, surface modified (C008B-270530)
Price: $228.66List Price: $254.07Nanoclay, surface modified (C008B-270530)
