Skip to main content

Probes & Primers

  
  • Image coming soon
    Add to Cart The item has been added
    PRIMER.COVID-19-7

    TTCTTGCTTTCGTGGTATTC Coronavirus Primers

    Price: $9.58
    List Price: $10.65
    Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed.
    SKUPRIMER.COVID-19-7
    MFR. NameBio Basic Inc
    Catalog No. C08-0300-759
    Pack Size 1 EA
    Price:
    Price: $9.58
    List Price: $10.65
    Quantity:
     
    Add to Cart The item has been added