Terodiline

4-(Thiophen-2-yl)aniline

Application 4-(Thiophen-3-yl)aniline can be used as a reactant to synthesize: Pd(I)–poly[4-(thiophen-3yl)-aniline] composite material by in situ polymerization and composite formation method. Schiff base,

BD supplies more than 400 different BD Difco™ and BD BBL™ brand media formulations and ingredients in dehydrated form for the convenience of the laboratorian and bioprocessing specialist.

MF: C5H11NO3 MF: 133.15 CAS: 4144-02-9 Purity: 0.99

M r : 5987 T7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors. Warning Toxicity: Standard Handling (A) Sequence 5&#697 - AACCCCTCAAGACCCGTTTA - 3&#697

Application Refer to the product&#8242s Certificate of Analysis for more information on a suitable instrument technique. Contact Technical Service for further support.

Application Refer to the product&#8242s Certificate of Analysis for more information on a suitable instrument technique. Contact Technical Service for further support.

Application Terpineol has been used as a high-viscosity solvent along with ethyl cellulose as a resin to prepare dispersion paste of titanium dioxide (TiO 2 ) that is used in dye-sensitized solar cell (DSSC) technology. It can also be used in the

Application Terpineol has been used as a high-viscosity solvent along with ethyl cellulose as a resin to prepare dispersion paste of titanium dioxide (TiO 2 ) that is used in dye-sensitized solar cell (DSSC) technology. It can also be used in the

Application Terpineol has been used as a high-viscosity solvent along with ethyl cellulose as a resin to prepare dispersion paste of titanium dioxide (TiO 2 ) that is used in dye-sensitized solar cell (DSSC) technology. It can also be used in the

tert -Butanol is a tertiary alcohol. Aqueous potassium peroxodisulphate undergoes photolysis in the presence of tert -butanol on irradiation with 254nm light at 20°C.

tert -Butanol is a tertiary alcohol. Aqueous potassium peroxodisulphate undergoes photolysis in the presence of tert -butanol on irradiation with 254nm light at 20°C.