Radiopharmaceuticals and contrast media

The BUCHI accessory is suitable for use with Rotavapor® or Multivapor™ evaporator unit models or with Sepacore® flash system models. You can choose ideal replacement part or accessory which ensures smooth functioning of evaporator units.

T-CAL&reg Turbidity Standards are stable Formazin standards prepared in ready-to-use concentrations to ensure accurate turbidity measurements. All concentrations are verified to meet tight quality control specifications, are EPA & ISO compliant for

T-CAL&reg Turbidity Standards are stable Formazin standards prepared in ready-to-use concentrations to ensure accurate turbidity measurements. All concentrations are verified to meet tight quality control specifications, are EPA & ISO compliant for

T/CWIRE:TYPE-K:24-GA:GL:100

T/CWIRE:TYPE-T:24-GA:GL:100

T47D/TR-1 cells are ER alpha positive and express progesterone receptor, although at reduced level compared to parental T7D/S2 cells. T47D/TR-1 cells are growth inhibited by fulvestrant.

M r : 6105 Warning Toxicity: Standard Handling (A) Sequence 5&#697 - GGAGCTGTCGTATTCCAGTC - 3&#697 Legal Information NOVAGEN is a registered trademark of Merck KGaA, Darmstadt, Germany

Application Employed in the synthesis of metal-rich layered tellurides, TaNi 2 Te 2 and TaCo 2 Te 2 , which possess ideal characteristics for photovoltaic applications, for surface scanning studies, and which may give clean and atomically flat

Application Employed in the synthesis of metal-rich layered tellurides, TaNi 2 Te 2 and TaCo 2 Te 2 , which possess ideal characteristics for photovoltaic applications, for surface scanning studies, and which may give clean and atomically flat

Quantity 13 g = 1 m 65 g = 5 m

Quantity 10.4 g = 25 × 25 mm 41.

The structure of tantalum is body centered cubic (BCC) metal. It is a refractory metal stable up to very high temperatures.