Technetium Tc-99m/99mtc pintumomab

Application foaming detergent for cleaning all glass and metallic equipment in virology and medicine Other Notes Sales restrictions may apply Legal Information RBS is a trademark of Chemical Products R. Borghgraef S.

SOLN ISA 5M NACL PINT

M r : 6105 Warning Toxicity: Standard Handling (A) Sequence 5&#697 - GGAGCTGTCGTATTCCAGTC - 3&#697 Legal Information NOVAGEN is a registered trademark of Merck KGaA, Darmstadt, Germany

Chromocult &#174 Tryptone Bile X-glucuronide agar is a selective medium for the enumeration of Escherichia coli . The presence of the enzyme &#946-D-glucuronidase differentiates most E.

Method: reflectometric with test strips 5 - 100 mg/l Mg Reflectoquant &#174 The Reflectoquant Magnesium test is suitable for determining magnesium ions in groundwater and surface water, drinking water, mineral water, boiler water and food after

Method: Reflectometric with test strips 5 - 125 mg/L (Ca), Reflectoquant &#174 The Reflectoquant &#174 Calcium test is suitable for rapid determination of calcium in aqueous media. Calcium is an important parameter for boiling and cooling water,

Method: reflectometric with test strips 3.0 - 60.

Method: reflectometric with test strips 5.0 - 60.

This product was derived from ATCC Cat. No.