-
Add to Cart The item has been added2019-nCoV_N1-PThomas Scientific
2019-nCoV_N1-P, ACCCCGCATTACGTTTGGTGGACC, 24 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $297.42List Price: $330.47To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N1-RThomas Scientific
2019-nCoV_N1-R, TCTGGTTACTGCCAGTTGAATCTG, 24 bases, HPLC Purified, 2 OD
Price: $28.39List Price: $31.55To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N2-FThomas Scientific
2019-nCoV_N2-F, TTACAAACATTGGCCGCAAA, 20 bases, HPLC Purified, 2 OD
Price: $26.29List Price: $29.21To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N2-PThomas Scientific
2019-nCoV_N2-P, ACAATTTGCCCCCAGCGCTTCAG, 23 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $297.04List Price: $330.05To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N2-RThomas Scientific
2019-nCoV_N2-R, GCGCGACATTCCGAAGAA, 18 bases, HPLC Purified, 2 OD
Price: $25.24List Price: $28.05To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N3-FThomas Scientific
2019-nCoV_N3-F, GGGAGCCTTGAATACACCAAAA, 22 bases, HPLC Purified, 2 OD
Price: $27.34List Price: $30.38To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N3-PThomas Scientific
2019-nCoV_N3-P, AYCACATTGGCACCCGCAATCCTG, 24 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $297.42List Price: $330.47To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N3-RThomas Scientific
2019-nCoV_N3-R, TGTAGCACGATTGCAGCATTG, 21 bases, HPLC Purified, 2 OD
Price: $26.84List Price: $29.82To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been addedIB7201020X SSC buffer is a solution formulated for use in nucleic acid preparation and blotting applications, including northern blotting. It is used in concentrations ranging from 0.2X to 20X solutions, depending on the application. -
Add to Cart The item has been addedIB7201520X SSPE buffer is a solution formulated for use in nucleic acid hybridization applications. -
Add to Cart The item has been added8310-4LFormula: Sodium Chloride 0.150 M, Sodium Citrate 0.015 M, on 20X dilution Formula Weight: CAS Number: 6132-04-3 Synonym(s): SSC Buffer Description: Analytical reagent -
Add to Cart The item has been addedA10237-22Formula: C13H10O5 Formula weight: 246.22 Purity: 98+% CAS Number: 131-55-5 Harmonized Tariff Code: 2914.
