-
SQRTAK-200
Thomas Scientific
Reverse transcriptase and HotStart Taq polymerase Master Mix
Price: $793.87List Price: $882.08Enzymes and buffers SeqOnce Master Mixes and reagents accurately and efficiently amplify nucleic acid from your sample. Just add your SeqOnce probe and primer panel with your sample together with the Master Mix and the reaction is ready to go. -
SQPRTAK-200
Thomas Scientific
Reverse transcriptase and HotStart Taq polymerase Master Mix with dUTP/UDG to reduce carry-over contamination risk
Price: $793.87List Price: $882.08Enzymes and buffers SeqOnce Master Mixes and reagents accurately and efficiently amplify nucleic acid from your sample. Just add your SeqOnce probe and primer panel with your sample together with the Master Mix and the reaction is ready to go. -
RG90910KRiboGuard&trade RNase Inhibitor is a recombinant protein that is the best defense against common RNases, including RNase A, RNase B, and RNase C.
-
RG90925RiboGuard&trade RNase Inhibitor is a recombinant protein that is the best defense against common RNases, including RNase A, RNase B, and RNase C.
-
RN02825One tube each of ATP, CTP, GTP and UTP at 100 mM. Each is provided as a sterile, neutral solution.
-
RNR07250Ribonuclease R (RNase R) from E. coli is a magnesium-dependent 3´&prime&rarr5´ exoribonuclease that digests essentially all linear RNAs but does not digest lariat or circular RNA structures.
-
RP8092HRNA 5´ Polyphosphatase is a Mg2+-independent phosphohydrolase discovered and characterized by Epicentre scientists. The enzyme sequentially removes the ? and ß phosphates from 5´-triphosphorylated RNA (such as primary RNA transcripts): 5´ pppN—OH 3´
-
MRNA092This reagent is designed for use with the MasterPure&trade kit protocols only.
-
N6901KRNase I degrades single-stranded RNA to nucleoside 3´ monophosphates via 2´,3´ cyclic monophosphate intermediates by cleaving between all dinucleotide pairs,2,3 unlike RNase A, which cleaves only after cytosine and uridine. In addition, the enzyme
-
RP-F
Thomas Scientific
RNAse P (RP-F), AGATTTGGACCTGCGAGCG, 19 bases, HPLC Purified, 2 OD
Price: $25.79List Price: $28.65To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
RP-P
Thomas Scientific
RNAse P (RP-P), TTCTGACCTGAAGGCTCTGCGCG, 23 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $297.04List Price: $330.05To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
RP-R
Thomas Scientific
RNAse P (RP-R), GAGCGGCTGTCTCCACAAGT, 20 bases, HPLC Purified, 2 OD
Price: $26.29List Price: $29.21To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus).