-
Add to Cart The item has been addedAGX8062019-NCOV NUCLEOCAPSID RECOMBINANT ANTIG (C005B-246821)
Price: $1,818.71List Price: $2,020.79General description This E. coli recombinant protein 2019-nCoV Nucleocapsid Recombinant Antigen,full length (Ag-6), Cat. -
Add to Cart The item has been addedAGX8082019-NCOV NUCLEOCAPSID RECOMBINANT ANTIG (C005B-246823)
Price: $1,818.71List Price: $2,020.79General description This E. coli recombinant protein 2019-nCoV Nucleocaspid Recombinant Antigen,full length (Ag-8), Cat. -
Add to Cart The item has been added2019-nCoV_N2-F2019-nCoV_N2-F, TTACAAACATTGGCCGCAAA, 20 bases, HPLC Purified, 2 OD
Price: $29.29List Price: $32.55To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N2-P2019-nCoV_N2-P, ACAATTTGCCCCCAGCGCTTCAG, 23 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $336.37List Price: $373.74To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N2-R2019-nCoV_N2-R, GCGCGACATTCCGAAGAA, 18 bases, HPLC Purified, 2 OD
Price: $28.09List Price: $31.21To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N3-F2019-nCoV_N3-F, GGGAGCCTTGAATACACCAAAA, 22 bases, HPLC Purified, 2 OD
Price: $30.46List Price: $33.85To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N3-P2019-nCoV_N3-P, AYCACATTGGCACCCGCAATCCTG, 24 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $336.79List Price: $374.21To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N3-R2019-nCoV_N3-R, TGTAGCACGATTGCAGCATTG, 21 bases, HPLC Purified, 2 OD
Price: $29.91List Price: $33.23To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added94031659-DNA-5UG205 BLCL
Price: $752.18List Price: $835.76205 BLCL -
Add to Cart The item has been added171-96RS20ul Tecan Freedom EVO Tips, Sterile, 4,800 Tips/Case.
Price: $1,030.55List Price: $1,145.05Fits: Tecan Genesis and PE Multiprobe II HT. -
Add to Cart The item has been addedZ287-24HEM24 - place hematocrit tube rotor for Z287-A (C016B-001153)
Price: $1,557.93List Price: $1,731.0324 - place hematocrit tube rotor for Z287-A -
Add to Cart The item has been added94031683-DNA-5UG247 BLCL
Price: $752.18List Price: $835.76247 BLCL
