-
Add to Cart The item has been addedPRIMER.COVID-19-11ACAGGTACGTTAATAGTTAATAGCGT Coronavirus Primers
Price: $12.74List Price: $14.15Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedPRIMER.COVID-19-2ACGATTGTGCATCAGCTGA Coronavirus Primers
Price: $9.29List Price: $10.32Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedHPA008853-25Anti-ATRN attractin, 25ul UN 1687 6.1 PG2
Price: $588.44List Price: $653.82Anti-ATRN attractin, 25ul UN 1687 6.1 PG2 -
Add to Cart The item has been addedMABE1870-25UGANTI-TTC23L CLONE 2A4 25 MIG
Price: $332.08List Price: $368.98ANTI-TTC23L CLONE 2A4 25 MIG -
Add to Cart The item has been addedA1371987-1mgATAC21
Price: $4,675.21List Price: $5,194.68ATAC21, a linker-immune-stimulatory compound that can be formed by conjugating a noncleavable maleimide-PEG4 linker containing a succinimide group with an immune- stimulatory compound. ATAC21 can be combined with SBT-040 (anti-CD40 antibody) to form -
Add to Cart The item has been addedPRIMER.COVID-19-10CARATGTTAAASACACTATTAGCATA Coronavirus Primers
Price: $12.74List Price: $14.15Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedPRIMER.COVID-19-6CTTGACAAAGTGGTCGTTGAG Coronavirus Primers
Price: $10.31List Price: $11.45Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedC34804581EXO2-MIGL-04-L EXO MTR IMPACT GLV GOATSKIN LRG BLACK
Price: $51.11List Price: $56.79EXO2-MIGL-04-L EXO MTR IMPACT GLV GOATSKIN LRG BLACK -
Add to Cart The item has been addedPRIMER.COVID-19-3GGGGAACTTCTCCTGCTAGAAT Coronavirus Primers
Price: $10.80List Price: $12.00Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedPRIMER.COVID-19-5GGTGGTCTCCTCTGACTTCA Coronavirus Primers
Price: $9.82List Price: $10.91Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedPRIMER.COVID-19-9GTGARATGGTCATGTGTGGCGG Coronavirus Primers
Price: $10.80List Price: $12.00Coronavirus Primers These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (COVID-19) related projects for as long as it is needed. -
Add to Cart The item has been addedZ-Path-A.orthoreovirusReal-Time PCR Detection Kit for Avian orthoreoVirus, 150 reactions
Price: $1,540.83List Price: $1,712.03Product Features: Exceptional value for money Rapid detection of all clinically relevant subtypes Positive copy number standard curve for quantification Highly specific detection profile High priming efficiency Broad dynamic detection range (>6 lo
