-
Add to Cart The item has been added2019-nCoV_N1-F2019-nCoV_N1-F, GACCCCAAAATCAGCGAAAT, 20 bases, HPLC Purified, 2 OD
Price: $29.29List Price: $32.55To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N1-P2019-nCoV_N1-P, ACCCCGCATTACGTTTGGTGGACC, 24 bases, HPLC Purified, 2 OD mods: 5 6-FAM, 3 BHQ1
Price: $336.81List Price: $374.24To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been added2019-nCoV_N1-R2019-nCoV_N1-R, TCTGGTTACTGCCAGTTGAATCTG, 24 bases, HPLC Purified, 2 OD
Price: $31.63List Price: $35.15To help speed up the generation of a vaccine against the virus, ready-to-use primers and probes for COVID-19 (SARS-CoV-2, Coronavirus). -
Add to Cart The item has been addedMAB810XANTI-CYTOMEGALOVIRUS ANTIBODY CLONE 8B1.2 ALEXA FLUOR« 488 (ASR)
Price: $1,308.59List Price: $1,453.99General description Human cytomegalovirus (HCMV) is a ubiquitous human pathogen that belongs to the herpes adenovirus family. The viral life cycle takes approximately seventy two hours. -
Add to Cart The item has been addedMAB810R-500UGANTI-CYTOMEGALOVIRUS ANTIBODY CLONE 8B1.2 (C15-1888-594)
Price: $3,610.61List Price: $4,011.79General description Human cytomegalovirus (HCMV) is a ubiquitous human pathogen that belongs to the herpes adenovirus family. The viral life cycle takes approximately seventy two hours. -
Add to Cart The item has been addedMAB810RANTI-CYTOMEGALOVIRUS ANTIBODY CLONE 8B1.2 (C15-1888-595)
Price: $1,259.59List Price: $1,399.54General description Human cytomegalovirus (HCMV) is a ubiquitous human pathogen that belongs to the herpes adenovirus family. The viral life cycle takes approximately seventy two hours. -
Add to Cart The item has been addedABE74ANTI-FOXP4 ANTIBODY (C15-1317-221)
Price: $805.85List Price: $895.38Forkhead box protein P4 (FoxP4) is a multidomain transcriptional repressor. This protein is a member of the Fox family of proteins characterized by it unique winged-helix DNA binding motif. -
Add to Cart The item has been addedMABX43-1KCANTI-MARBURG ANTIBODY VIRUS 1 MG (C15-1884-703)
Price: $3,254.75List Price: $3,616.38Specificity Marburg Virus Immunogen Native Marburg Virus Application This mouse monoclonal antibody, Cat. No. -
Add to Cart The item has been addedMABX42-1KCANTI-MARBURG ANTIBODY VIRUS 1 MG (C15-1884-705)
Price: $3,254.75List Price: $3,616.38Specificity Marburg Virus Immunogen Native Marburg Virus Application This mouse monoclonal antibody, Cat. No. -
Add to Cart The item has been addedMABX43-10KCANTI-MARBURG ANTIBODY VIRUS 10 MG (C15-1884-704)
Price: $27,656.34List Price: $30,729.27Specificity Marburg Virus Immunogen Native Marburg Virus Application This mouse monoclonal antibody, Cat. No. -
Add to Cart The item has been addedMABX42-10KCANTI-MARBURG ANTIBODY VIRUS 10 MG (C15-1884-706)
Price: $27,656.34List Price: $30,729.27Specificity Marburg Virus Immunogen Native Marburg Virus Application This mouse monoclonal antibody, Cat. No. -
Add to Cart The item has been addedHPA026111-100ULANTI-NES (C15-1451-024)
Price: $959.88List Price: $1,066.53Nestin (NES) is a class VI cytoplasmic protein which is expressed in the intermediate filaments. It has a molecular weight of 177.
